ABCB7 (NM_004299) Human 3' UTR Clone

CAT#: SC200882

3`UTR clone of ATP-binding cassette sub-family B (MDR/TAP) member 7 (ABCB7) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABCB7
• Synonyms: ABC7; ASAT; Atm1p; EST140535
• ACCN: NM_004299
• Insert Size: 121
• Sequence Data:
  Insert Sequence

  >SC200882 3'UTR clone of NM_004299
  The sequence shown below is from the reference sequence of NM_004299. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGTGGAAACTGTTCGTGCTAAGTCACATAAGACATTTTCTTTTTTTGTTGTTTTGGACTACATATTTG
  CACTGAAGCAGAATTGTTTTATTAAAAAAATCATACATTCCCATTTTCTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004299.3
• Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a half-transporter involved in the transport of heme from the mitochondria to the cytosol. With iron/sulfur cluster precursors as its substrates, this protein may play a role in metal homeostasis. Mutations in this gene have been associated with mitochondrial iron accumulation and isodicentric (X)(q13) and sideroblastic anemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
• Locus ID: 22