CD3D (NM_001040651) Human 3' UTR Clone

CAT#: SC200889

3`UTR clone of CD3d molecule delta (CD3-TCR complex) (CD3D) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CD3D
• Synonyms: CD3-DELTA; IMD19; T3D
• ACCN: NM_001040651
• Insert Size: 112 bp
• Sequence Data:
  Insert Sequence

  >SC200889 3'UTR clone of NM_001040651
  The sequence shown below is from the reference sequence of NM_001040651. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCTCAGTACAGCCACCTTGGAGGAAACTGGGCTCGGAACAAGTGAACCTGAGACTGGTGGCTTCTAGAA
  GCAGCCATTACCAACTGTACCTTCCCTTCTTGCTCAGCCAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001040651.1
• Summary: 'The protein encoded by this gene is part of the T-cell receptor/CD3 complex (TCR/CD3 complex) and is involved in T-cell development and signal transduction. The encoded membrane protein represents the delta subunit of the CD3 complex, and along with four other CD3 subunits, binds either TCR alpha/beta or TCR gamma/delta to form the TCR/CD3 complex on the surface of T-cells. Defects in this gene are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (SCIDBNK). Two transcript variants encoding different isoforms have been found for this gene. Other variants may also exist, but the full-length natures of their transcripts has yet to be defined. [provided by RefSeq, Feb 2009]'
• Locus ID: 915