CYBA (NM_000101) Human 3' UTR Clone

CAT#: SC200907

3`UTR clone of cytochrome b-245 alpha polypeptide (CYBA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYBA
• Synonyms: CGD4; p22-PHOX
• ACCN: NM_000101
• Insert Size: 78 bp
• Sequence Data:
  Insert Sequence

  >SC200907 3'UTR clone of NM_000101
  The sequence shown below is from the reference sequence of NM_000101. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGACGAGGTCGTGTGACCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAG
  CGAAGCCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000101.2
• Summary: 'Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]'
• Locus ID: 1535