DcR3 (TNFRSF6B) (NM_032945) Human 3' UTR Clone

CAT#: SC200927

3`UTR clone of tumor necrosis factor receptor superfamily member 6b decoy (TNFRSF6B) transcript variant M68C for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TNFRSF6B
• Synonyms: DCR3; decoy receptor 3; DJ583P15.1.1; M68; OTTHUMP00000031583; TR6; tumor necrosis factor receptor superfamily, member 6b; tumor necrosis factor receptor superfamily, member 6b, decoy
• ACCN: NM_032945
• Insert Size: 113
• Sequence Data:
  Insert Sequence

  >SC200927 3'UTR clone of NM_032945
  The sequence shown below is from the reference sequence of NM_032945. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCTCCCTGTGCACTGATCCTGGCCCCCTCTTATTTATTCTACATCCTTGGCACCCCACTTGCACTGAAA
  GAGGCTTTTTTTTAAATAGAAGAAATGAGGTTTCTTAAAGCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_032945.2
• Summary: This gene belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. [provided by RefSeq, Feb 2011]
• Locus ID: 8771