RPC62 (POLR3C) (NM_006468) Human 3' UTR Clone

CAT#: SC200957

3`UTR clone of polymerase (RNA) III (DNA directed) polypeptide C (62kD) (POLR3C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLR3C
• Synonyms: RPC3; RPC62
• ACCN: NM_006468
• Insert Size: 88
• Sequence Data:
  Insert Sequence

  >SC200957 3'UTR clone of NM_006468
  The sequence shown below is from the reference sequence of NM_006468. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCACCATGAAGAGACAGTGATCCAGAAGAAGCATCTTCCTCAGAAGATCTGGGGGGATGGAAAGCAAAAT
  AAAGGAGGTGCCTGGATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006468.6
• Summary: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific core component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. May direct with other members of the subcomplex RNA Pol III binding to the TFIIIB-DNA complex via the interactions between TFIIIB and POLR3F. May be involved either in the recruitment and stabilization of the subcomplex within RNA polymerase III, or in stimulating catalytic functions of other subunits during initiation. Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts, such as Epstein-Barr virus-encoded RNAs (EBERs) induce type I interferon and NF- Kappa-B through the RIG-I pathway. Preferentially binds single-stranded DNA (ssDNA) in a sequence-independent manner (PubMed:21358628). [UniProtKB/Swiss-Prot Function]
• Locus ID: 10623