AASDH (NM_181806) Human 3' UTR Clone

CAT#: SC200961

3`UTR clone of aminoadipate-semialdehyde dehydrogenase (AASDH) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AASDH
• Synonyms: ACSF4; LYS2; NRPS998; NRPS1098
• ACCN: NM_181806
• Insert Size: 141
• Sequence Data:
  Insert Sequence

  >SC200961 3'UTR clone of NM_181806
  The sequence shown below is from the reference sequence of NM_181806. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCTGGATTTATTGGGTGGCAATCAAAAATAATCAAATACAGTCCTTATTTGTATAACAAATGTGAGATA
  TTTGAAAATATTTTACCATTATACATCATGTGGACTTATTTTATATTAAAGAAGATTATATTTTGGCTAA
  G
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_181806.2
• Summary: This gene encodes a member of the non-ribosome peptide syntesase (NRPS) enzyme family. The encoded protein contains an AMP-binding domain, PP-binding (phosphopantetheine, or pantetheine 4'phosphate-binding) domain and the Pyrrolo-quinoline quinon (PQQ) binding domain. The protein is expressed in several adult tissues. [provided by RefSeq, Apr 2016]
• Locus ID: 132949