PTOP (ACD) (NM_001082486) Human 3' UTR Clone

CAT#: SC200964

3`UTR clone of adrenocortical dysplasia homolog (mouse) (ACD) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACD
• Synonyms: PIP1; PTOP; TINT1; TPP1
• ACCN: NM_001082486
• Insert Size: 103
• Sequence Data:
  Insert Sequence

  >SC200964 3'UTR clone of NM_001082486
  The sequence shown below is from the reference sequence of NM_001082486. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTGAGCCAACTCCGATGTGAGACGTCACGCAGGACAGATACCGCTCCACACTCTGCTTCCTTTGAGTTT
  TTTAATAAAATAATCTCATGCGGCAGGAGAGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001082486.1
• Summary: This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I. [provided by RefSeq, Jul 2008]
• Locus ID: 65057