AKR1A1 (NM_153326) Human 3' UTR Clone

CAT#: SC200974

3`UTR clone of aldo-keto reductase family 1 member A1 (aldehyde reductase) (AKR1A1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AKR1A1
• Synonyms: ALDR1; ALR; ARM; DD3; HEL-S-6
• ACCN: NM_153326
• Insert Size: 106
• Sequence Data:
  Insert Sequence

  >SC200974 3'UTR clone of NM_153326
  The sequence shown below is from the reference sequence of NM_153326. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCAGGGCATCCTCTGTACCCCTTTAATGACCCGTACTGAGACCACAGCTTCTTGGCCTCCCTTCCAGCT
  CTGCAGCTAATGAGGTCCTGCCACAACGGAAAGAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_153326.1
• Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
• Locus ID: 10327