NCAPH2 (NM_152299) Human 3' UTR Clone

CAT#: SC201070

3`UTR clone of non-SMC condensin II complex subunit H2 (NCAPH2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NCAPH2
• Synonyms: CAPH2
• ACCN: NM_152299
• Insert Size: 140
• Sequence Data:
  Insert Sequence

  >SC201070 3'UTR clone of NM_152299
  The sequence shown below is from the reference sequence of NM_152299. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTTCCAGACCTACGCTGCCCCCTCCATGGCCCAGCCCTGAGTGGGGAGCACCGAGGCAGGGGTGGGGGA
  ATGTGTACTGAGGAGCCGTGTGTCTGCTCCTGGCTGGCCCGGCCTAATAAAGCAGTGTTGCCATCTCATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_152299.2
• Summary: This gene encodes one of the non-SMC subunits of the condensin II complex. This complex plays an essential role in mitotic chromosome assembly. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2010]
• Locus ID: 29781