Constitutive androstane receptor (NR1I3) (NM_001077481) Human 3' UTR Clone

CAT#: SC201083

3`UTR clone of nuclear receptor subfamily 1 group I member 3 (NR1I3) transcript variant 4 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NR1I3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NR1I3
Synonyms CAR; CAR1; MB67
ACCN NM_001077481
Insert Size 141
Sequence Data
>SC201083 3'UTR clone of NM_001077481
The sequence shown below is from the reference sequence of NM_001077481. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGATGCCGCTGCTCCAGGAGATCTGCAGCTGAGGCCATGCTCACTTCCTTCCCCAGCTCACCTGGAACA
CCCTGGATACACTGGAGTGGGAAAATGCTGGGACCAAAGATTGGGCCGGGTTCAAAGGGAGCCCAGTGGT
T

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001077481.1
Summary This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 9970

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.