Major Basic Protein (PRG2) (NM_002728) Human 3' UTR Clone

CAT#: SC201102

3`UTR clone of proteoglycan 2 bone marrow (natural killer cell activator eosinophil granule major basic protein) (PRG2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRG2
• Synonyms: BMPG; MBP; MBP1; proMBP
• ACCN: NM_002728
• Insert Size: 131 bp
• Sequence Data:
  Insert Sequence

  >SC201102 3'UTR clone of NM_002728
  The sequence shown below is from the reference sequence of NM_002728. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACTGCCTCAGAAGACTTCCTTTCATCTGTTCCTACTGAGCTGGTCCCAGCCAGCAGTTCAGAGCTGCCC
  TCTCCTGGGCAGCTGCCTCCCCTCCTCTGCTTGCCATCCCTCCCTCCACCTCCCTGCAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002728.4
• Summary: 'The protein encoded by this gene is the predominant constituent of the crystalline core of the eosinophil granule. High levels of the proform of this protein are also present in placenta and pregnancy serum, where it exists as a complex with several other proteins including pregnancy-associated plasma protein A (PAPPA), angiotensinogen (AGT), and C3dg. This protein may be involved in antiparasitic defense mechanisms as a cytotoxin and helminthotoxin, and in immune hypersensitivity reactions. The encoded protein contains a peptide that displays potent antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria, and fungi. It is directly implicated in epithelial cell damage, exfoliation, and bronchospasm in allergic diseases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]'
• Locus ID: 5553