CKMT1A (NM_001015001) Human 3' UTR Clone

CAT#: SC201144

3`UTR clone of creatine kinase mitochondrial 1A (CKMT1A) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CKMT1A
• Synonyms: CKMT1; mia-CK; U-MtCK
• ACCN: NM_001015001
• Insert Size: 157 bp
• Sequence Data:
  Insert Sequence

  >SC201144 3'UTR clone of NM_001015001
  The sequence shown below is from the reference sequence of NM_001015001. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCTGTCATCCACACCAAGCATTAACTCCCCATCGCCAGCTGATGACTCAAGATTCCAAGGAGTTCTGCT
  CATTCTAATGATGGCCCATTCTACTTGCTCTGGACCTGCCCTCGCATCCCCTGCCTCCATCCTAGTAAAG
  ACTCCTTGCTATGCTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001015001.1
• Summary: Mitochondrial creatine (MtCK) kinase is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Many malignant cancers with poor prognosis have shown overexpression of ubiquitous mitochondrial creatine kinase; this may be related to high energy turnover and failure to eliminate cancer cells via apoptosis. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric mitochondrial creatine kinase. Two genes located near each other on chromosome 15 have been identified which encode identical mitochondrial creatine kinase proteins. [provided by RefSeq, Jul 2008]
• Locus ID: 548596