ACOX2 (NM_003500) Human 3' UTR Clone

CAT#: SC201167

3`UTR clone of acyl-Coenzyme A oxidase 2 branched chain (ACOX2) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACOX2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ACOX2
Synonyms BCOX; BRCACOX; BRCOX; CBAS6; THCCox
ACCN NM_003500
Insert Size 81
Sequence Data
>SC201167 3'UTR clone of NM_003500
The sequence shown below is from the reference sequence of NM_003500. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGTTGGAGATCCAAGCTATGAAATAACCAACAGTATTCAAGAAGCAACCAGCACCATCATGTGATAATGG
TACTATGGCAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003500.3
Summary The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe cognitive disability, and death in children. [provided by RefSeq, Mar 2009]
Locus ID 8309

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.