ACOX2 (NM_003500) Human 3' UTR Clone
CAT#: SC201167
3`UTR clone of acyl-Coenzyme A oxidase 2 branched chain (ACOX2) for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "ACOX2"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ACOX2 |
Synonyms | BCOX; BRCACOX; BRCOX; CBAS6; THCCox |
ACCN | NM_003500 |
Insert Size | 81 |
Sequence Data |
>SC201167 3'UTR clone of NM_003500
The sequence shown below is from the reference sequence of NM_003500. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC AGTTGGAGATCCAAGCTATGAAATAACCAACAGTATTCAAGAAGCAACCAGCACCATCATGTGATAATGG TACTATGGCAT ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_003500.3 |
Summary | The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe cognitive disability, and death in children. [provided by RefSeq, Mar 2009] |
Locus ID | 8309 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.