APPBP1 (NAE1) (NM_003905) Human 3' UTR Clone

CAT#: SC201210

3`UTR clone of NEDD8 activating enzyme E1 subunit 1 (NAE1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NAE1
• Synonyms: A-116A10.1; APPBP1; HPP1; ula-1
• ACCN: NM_003905
• Insert Size: 137
• Sequence Data:
  Insert Sequence

  >SC201210 3'UTR clone of NM_003905
  The sequence shown below is from the reference sequence of NM_003905. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCATGTCACAAACTTCAGCAACTTTCCAGTTGTAGAGTAAGCAAGCACCTTAAGTAGTGTGTTAATGAT
  TGAAACTGTAATTGCCTTCGGGTTGTGCTTTAGTCTGTAAAATTCTAAAGGAGAGCTGCTAAATTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003905.3
• Summary: The protein encoded by this gene binds to the beta-amyloid precursor protein. Beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. In addition, the encoded protein can form a heterodimer with UBE1C and bind and activate NEDD8, a ubiquitin-like protein. This protein is required for cell cycle progression through the S/M checkpoint. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 8883