DHX16 (NM_001164239) Human 3' UTR Clone

CAT#: SC201231

3`UTR clone of DEAH (Asp-Glu-Ala-His) box polypeptide 16 (DHX16) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DHX16
• Synonyms: DBP2; DDX16; PRO2014; Prp2; PRP8; PRPF2
• ACCN: NM_001164239
• Insert Size: 135
• Sequence Data:
  Insert Sequence

  >SC201231 3'UTR clone of NM_001164239
  The sequence shown below is from the reference sequence of NM_001164239. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCAAAACACGAGAAGAGCTAGGGTAAGAGAAGGACGTAAACAGAACCTGACACCAGCTCCTTTTCCTTC
  TATACATTATTTAATACCTATTAAATAAAATTATTTTTGGAATAAAGCTTGTGGGAACATTTGGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001164239.1
• Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2018]
• Locus ID: 8449