S100A4 (NM_019554) Human 3' UTR Clone

CAT#: SC201245

3`UTR clone of S100 calcium binding protein A4 (S100A4) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "S100A4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol S100A4
Synonyms 18A2; 42A; CAPL; FSP1; MTS1; P9KA; PEL98
ACCN NM_019554
Insert Size 134 bp
Sequence Data
>SC201245 3'UTR clone of NM_019554
The sequence shown below is from the reference sequence of NM_019554. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATAAGCAGCCCAGGAAGAAATGAAAACTCCTCTGATGTGGTTGGGGGGTCTGCCAGCTGGGGCCCTCCC
TGTCGCCAGTGGGCACTTTTTTTTTTCCACCCTGGCTCCTTCAGACACGTGCTTGATGCTGAGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_019554.2
Summary 'The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]'
Locus ID 6275

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.