Complement C4A (C4A) (NM_007293) Human 3' UTR Clone

CAT#: SC201250

3`UTR clone of complement component 4A (Rodgers blood group) (C4A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C4A
• Synonyms: C4; C4A2; C4A3; C4A4; C4A6; C4AD; C4S; CO4; CPAMD2; RG
• ACCN: NM_007293
• Insert Size: 180 bp
• Sequence Data:
  Insert Sequence

  >SC201250 3'UTR clone of NM_007293
  The sequence shown below is from the reference sequence of NM_007293. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AACGACTTCCTCCAGGAGTATGGCACTCAGGGGTGCCAGGTGTGAGGGCTGCCCTCCCACCTCCGCTGGG
  AGGAACCTGAACCTGGGAACCATGAAGCTGGAAGCACTGCTGTGTCCGCTTTCATGAACACAGCCTGGGA
  CCAGGGCATATTAAAGGCTTTTGGCAGCAAAGTGTCAGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_007293.2
• Summary: 'This gene encodes the acidic form of complement factor 4, part of the classical activation pathway. The protein is expressed as a single chain precursor which is proteolytically cleaved into a trimer of alpha, beta, and gamma chains prior to secretion. The trimer provides a surface for interaction between the antigen-antibody complex and other complement components. The alpha chain is cleaved to release C4 anaphylatoxin, an antimicrobial peptide and a mediator of local inflammation. Deficiency of this protein is associated with systemic lupus erythematosus and type I diabetes mellitus. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. Varying haplotypes of this gene cluster exist, such that individuals may have 1, 2, or 3 copies of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]'
• Locus ID: 720