CPVL (NM_019029) Human 3' UTR Clone

CAT#: SC201264

3`UTR clone of carboxypeptidase vitellogenic-like (CPVL) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CPVL
• Synonyms: HVLP
• ACCN: NM_019029
• Insert Size: 159
• Sequence Data:
  Insert Sequence

  >SC201264 3'UTR clone of NM_019029
  The sequence shown below is from the reference sequence of NM_019029. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGATGGGATCCTTATGTTGGATAAACTACCTTCCCAAAAGAGAACATCAGAGGTTTTCATTGCTGAAAAG
  AAAATCGTAAAAACAGAAAATGTCATAGGAATAAAAAAATTATCTTTTCATATCTGCAAGATTTTTTTCA
  TCAATAAAAATTATCCTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_019029.2
• Summary: The protein encoded by this gene is a carboxypeptidase and bears strong sequence similarity to serine carboxypeptidases. Carboxypeptidases are a large class of proteases that act to cleave a single amino acid from the carboxy termini of proteins or peptides. The exact function of this protein, however, has not been determined. [provided by RefSeq, Jan 2017]
• Locus ID: 54504