Von Willebrand Factor (VWF) (NM_000552) Human 3' UTR Clone

CAT#: SC201273

3`UTR clone of von Willebrand factor (VWF) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VWF
• Synonyms: F8VWF; VWD
• ACCN: NM_000552
• Insert Size: 140 bp
• Sequence Data:
  Insert Sequence

  >SC201273 3'UTR clone of NM_000552
  The sequence shown below is from the reference sequence of NM_000552. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGAAGTGCAGCAAGTGAGGCTGCTGCAGCTGCATGGGTGCCTGCTGCTGCCTGCCTTGGCCTGATGGCC
  AGGCCAGAGTGCTGCCAGTCCTCTGCATGTTCTGCTCTTGTGCCCTTCTGAGCCCACAATAAAGGCTGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000552.3
• Summary: 'This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]'
• Locus ID: 7450