Aurora C (AURKC) (NM_003160) Human 3' UTR Clone

CAT#: SC201278

3`UTR clone of aurora kinase C (AURKC) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AURKC"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AURKC
Synonyms AIE2; AIK3; ARK3; AurC; aurora-C; HEL-S-90; SPGF5; STK13
ACCN NM_003160
Insert Size 150 bp
Sequence Data
>SC201278 3'UTR clone of NM_003160
The sequence shown below is from the reference sequence of NM_003160. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGTGCTCAGATGGCTTCCTGAGCCCTGTCTGCCTCTGTTCCCTTTGTGTGTGTTCAGGGAGCTCTCCTGG
CTCTGCCACCTCATTTGTCTTTATTTTTTTCTCTTTTAAGATGTAAGATGCTAATTAATAAAAGCTGAAT
CATTTCATAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003160.2
Summary 'This gene encodes a member of the Aurora subfamily of serine/threonine protein kinases. The encoded protein is a chromosomal passenger protein that forms complexes with Aurora-B and inner centromere proteins and may play a role in organizing microtubules in relation to centrosome/spindle function during mitosis. This gene is overexpressed in several cancer cell lines, suggesting an involvement in oncogenic signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]'
Locus ID 6795

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.