Asparagine synthetase (ASNS) (NM_133436) Human 3' UTR Clone

CAT#: SC201288

3`UTR clone of asparagine synthetase (ASNS) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ASNS
• Synonyms: ASNSD; TS11
• ACCN: NM_133436
• Insert Size: 130 bp
• Sequence Data:
  Insert Sequence

  >SC201288 3'UTR clone of NM_133436
  The sequence shown below is from the reference sequence of NM_133436. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCCACTACAAGTCAGCTGTCAAAGCTTAGGTGGTCTTTATGCTGTAATGTGAAAGCAAATATTTCTTCG
  TGTTGGATGGGGACTGTGGGTAGATAGGGGAACAATGAGAGTCAACTCAGGCTAACTTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_133436.2
• Summary: 'The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]'
• Locus ID: 440