GPSN2 (TECR) (NM_138501) Human 3' UTR Clone

CAT#: SC201300

3`UTR clone of trans-23-enoyl-CoA reductase (TECR) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TECR
• Synonyms: GPSN2; MRT14; SC2; TER
• ACCN: NM_138501
• Insert Size: 109
• Sequence Data:
  Insert Sequence

  >SC201300 3'UTR clone of NM_138501
  The sequence shown below is from the reference sequence of NM_138501. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCATCCCCTTCCTGCTCTGAGCGCTCACCCCTGCTGAGGCTCAGCCCCTCAACCCGGTGGCATTCTGGG
  GGAGGAGTGGGGCCCACAGCTCTCCAGCACCCGGAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_138501.4
• Summary: This gene encodes a multi-pass membrane protein that resides in the endoplasmic reticulum, and belongs to the steroid 5-alpha reductase family. The elongation of microsomal long and very long chain fatty acid consists of 4 sequential reactions. This protein catalyzes the final step, reducing trans-2,3-enoyl-CoA to saturated acyl-CoA. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2011]
• Locus ID: 9524