MAP126 (SPAG5) (NM_006461) Human 3' UTR Clone

CAT#: SC201410

3`UTR clone of sperm associated antigen 5 (SPAG5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SPAG5
• Synonyms: DEEPEST; hMAP126; MAP126
• ACCN: NM_006461
• Insert Size: 138
• Sequence Data:
  Insert Sequence

  >SC201410 3'UTR clone of NM_006461
  The sequence shown below is from the reference sequence of NM_006461. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAACTACAGGGATTGCTGGAATTTCTGAGCTAAGAAACTGAAAGCCAGAATCTGCTTCACCTCTTTTTAC
  CTGCAATACCCCCTTACCCCAATACCAAGACCAACTGGCATAGAGCCAACTGAGATAAATGCTATTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006461.3
• Summary: This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
• Locus ID: 10615