Cytochrome P450 2E1 (CYP2E1) (NM_000773) Human 3' UTR Clone

CAT#: SC201431

3`UTR clone of cytochrome P450 family 2 subfamily E polypeptide 1 (CYP2E1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP2E1
• Synonyms: CPE1; CYP2E; P450-J; P450C2E
• ACCN: NM_000773
• Insert Size: 188 bp
• Sequence Data:
  Insert Sequence

  >SC201431 3'UTR clone of NM_000773
  The sequence shown below is from the reference sequence of NM_000773. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGTATCCCACCACGTTACAAACTCTGTGTCATTCCCCGCTCATGAGTGTGTGGAGGACACCCTGAACCC
  CCCGCTTTCAAACAAGTTTTCAAATTGTTTGAGGTCAGGATTTCTCAAACTGATTCCTTTCTTTGCATAT
  GAGTATTTGAAAATAAATATTTTCCCAGAATATAAATAAATCATCACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000773.3
• Summary: 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]'
• Locus ID: 1571