CMTM1 (NM_181272) Human 3' UTR Clone

CAT#: SC201443

3`UTR clone of CKLF-like MARVEL transmembrane domain containing 1 (CMTM1) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CMTM1
• Synonyms: CKLFH; CKLFH1; CKLFSF1
• ACCN: NM_181272
• Insert Size: 153
• Sequence Data:
  Insert Sequence

  >SC201443 3'UTR clone of NM_181272
  The sequence shown below is from the reference sequence of NM_181272. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACGCCTACCCCGAAACCGGCCCCGACGCCCCGCAGAGGCCCGCCTGAAGCCAGCCCGGCGCCCTAGCAGA
  TGCACGTGTCTGTCGAATCGCTGCCTCCGAGCCCACCCCCGAGCTCGCATGCTGTCACCCATTCCAGCCT
  AAATGTGACCATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_181272.2
• Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor). [provided by RefSeq, Feb 2011]
• Locus ID: 113540