5HT4 Receptor (HTR4) (NM_001040169) Human 3' UTR Clone

CAT#: SC201444

3`UTR clone of 5-hydroxytryptamine (serotonin) receptor 4 (HTR4) transcript variant a for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HTR4
• Synonyms: 5-HT4; 5-HT4R
• ACCN: NM_001040169
• Insert Size: 197 bp
• Sequence Data:
  Insert Sequence

  >SC201444 3'UTR clone of NM_001040169
  The sequence shown below is from the reference sequence of NM_001040169. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCCCATACACAATGACCCAGAATCCCTGGAATCATGCTTCTGATTGAGGACATGGCTCACAACTTAGCC
  ATTCATTCGCATTCATGTTTGCATGAACAGGTCACCCTGGCATCACTTCTGAACCTCATCACCACCAGTG
  AGGCATCAGGTAGTAGGGGCTGAGAGCCCAGAGGAGGTACATGGAGGACAGTGTTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001040169.1
• Summary: 'This gene is a member of the family of serotonin receptors, which are G protein coupled receptors that stimulate cAMP production in response to serotonin (5-hydroxytryptamine). The gene product is a glycosylated transmembrane protein that functions in both the peripheral and central nervous system to modulate the release of various neurotransmitters. Multiple transcript variants encoding proteins with distinct C-terminal sequences have been described. [provided by RefSeq, May 2010]'
• Locus ID: 3360