CNTN4 (NM_175613) Human 3' UTR Clone

CAT#: SC201451

3`UTR clone of contactin 4 (CNTN4) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CNTN4
• Synonyms: AXCAM; BIG-2
• ACCN: NM_175613
• Insert Size: 142
• Sequence Data:
  Insert Sequence

  >SC201451 3'UTR clone of NM_175613
  The sequence shown below is from the reference sequence of NM_175613. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCACAGCTAGGTCCAGTTTATGACAAAAGTTATCTGAAGGACTTGCTGTTTATAATATAAGCAACATTT
  AGCTAGTTGTTTTGAAGACACCCAGTACTAAGTAATATTGTTGTTCAAGTACATCTTATTACTGGAATAA
  AA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_175613.1
• Summary: This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
• Locus ID: 152330