LXR alpha (NR1H3) (NM_001130102) Human 3' UTR Clone

CAT#: SC201478

3`UTR clone of nuclear receptor subfamily 1 group H member 3 (NR1H3) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NR1H3
• Synonyms: LXR-a; LXRA; RLD-1
• ACCN: NM_001130102
• Insert Size: 169
• Sequence Data:
  Insert Sequence

  >SC201478 3'UTR clone of NM_001130102
  The sequence shown below is from the reference sequence of NM_001130102. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCGCTGCTCTCTGAGATCTGGGATGTGCACGAATGACTGTTCTGTCCCCATATTTTCTGTTTTCTTGGC
  CGGATGGCTGAGGCCTGGTGGCTGCCTCCTAGAAGTGGAACAGACTGAGAAGGGCAAACATTCCTGGGAG
  CTGGGCAAGGAGATCCTCCCGTGGCATTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001130102.1
• Summary: The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
• Locus ID: 10062