Leukotriene A4 hydrolase (LTA4H) (NM_000895) Human 3' UTR Clone

CAT#: SC201507

3`UTR clone of leukotriene A4 hydrolase (LTA4H) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LTA4H
• ACCN: NM_000895
• Insert Size: 177 bp
• Sequence Data:
  Insert Sequence

  >SC201507 3'UTR clone of NM_000895
  The sequence shown below is from the reference sequence of NM_000895. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTGACTGCAATGCTGGTGGGGAAAGACTTAAAAGTGGATTAAAGACCTGCGTATTGATGATTTTAGAGA
  TTTCTCTTTTTTAAATGGAATTCGTAAAGAAATATAAAACTTCAGCTCACAATTAAAACTGTCTTTTTAG
  TTTTGGCTTTTTATTGTTTTGTTGGTGATTTTACTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000895.1
• Summary: 'The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]'
• Locus ID: 4048