BAF53b (ACTL6B) (NM_016188) Human 3' UTR Clone

CAT#: SC201603

3`UTR clone of actin-like 6B (ACTL6B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACTL6B
• Synonyms: ACTL6; arpNalpha; BAF53B
• ACCN: NM_016188
• Insert Size: 147
• Sequence Data:
  Insert Sequence

  >SC201603 3'UTR clone of NM_016188
  The sequence shown below is from the reference sequence of NM_016188. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGCGTGGAGCGAAAGTGCCCCTGATGGCACTCCTCCCCACACACCTGCTCCCAAGCTCAGATGGAAGT
  CCCTTAACCCCCATGCCACATTGCCCCCCTCCTCCTTTCCCTCTTGTCCTCATTAATGGTGATGTTTCTG
  GGTTGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016188.4
• Summary: The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a subunit of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. This subunit may be involved in the regulation of genes by structural modulation of their chromatin, specifically in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
• Locus ID: 51412