ABHD11 (NM_001145363) Human 3' UTR Clone

CAT#: SC201604

3`UTR clone of abhydrolase domain containing 11 (ABHD11) transcript variant 7 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABHD11
• Synonyms: abhydrolase domain containing 11; PP1226; WBSCR21; Williams Beuren syndrome chromosome region 21
• ACCN: NM_001145363
• Insert Size: 187
• Sequence Data:
  Insert Sequence

  >SC201604 3'UTR clone of NM_001145363
  The sequence shown below is from the reference sequence of NM_001145363. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGGTTCTTCATCTGGGCCTCCTAGGTCTGGAAACTGGGCCCTTCCCCTCCACAGGGTGTATCCCCAGG
  CTCTCCACACCTTTGACCTGCTGTCCCTACAAGCCTTTGGCTGTCTACCCCCAGAATGGGGATATCAACG
  CAGCCCCGTCTCACCCCACTCCCCAGGTGCTGACGGTGGATGCTCGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001145363.1
• Summary: This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Mar 2016]
• Locus ID: 83451