PRMT10 (PRMT9) (NM_138364) Human 3' UTR Clone

CAT#: SC201605

3`UTR clone of protein arginine methyltransferase 10 (putative) (PRMT10) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRMT9
• Synonyms: PRMT10
• ACCN: NM_138364
• Insert Size: 167
• Sequence Data:
  Insert Sequence

  >SC201605 3'UTR clone of NM_138364
  The sequence shown below is from the reference sequence of NM_138364. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAATGTCAGCATCACAGTAAAGCAATGAAGAGCAGTTTTCCAATGAAAACTGTGTAAATAGAGCATCAA
  CAAGTACAAAATTCTTGTCTTAATTAGTGGGGGTATATAAAAATTCCTTGTAATGGTCAAATATTTTTTA
  AAATTGACATTAATAAAGCATATTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_138364.2
• Summary: This gene encodes a type II methyltransferase. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to the guanidino nitrogen atoms of arginine. The protein encoded by this gene methylates spliceosome associated protein 145 to regulate alternative splicing and acts as a modulator of small nuclear ribonucleoprotein maturation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2017]
• Locus ID: 90826