Tbp7 (PSMC4) (NM_153001) Human 3' UTR Clone

CAT#: SC201607

3`UTR clone of proteasome (prosome macropain) 26S subunit ATPase 4 (PSMC4) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSMC4
• Synonyms: MIP224; RPT3; S6; TBP-7; TBP7
• ACCN: NM_153001
• Insert Size: 159 bp
• Sequence Data:
  Insert Sequence

  >SC201607 3'UTR clone of NM_153001
  The sequence shown below is from the reference sequence of NM_153001. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACTGTCATCAAGAAGGACGAGCAGGAGCATGAGTTTTACAAGTGACCCTTCCCTTCCCTCCACCACACC
  ACTCAGGGGCTGGGGCTTCTCTCGCACCCCCAGCACCTCTGTCCCAAAACCTCATTCCCTTTTTTCTTTA
  CCCAGGATTGGTTTCTTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_153001.1
• Summary: 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the triple-A family of ATPases that is a component of the 19S regulatory subunit and plays a role in 26S proteasome assembly. The encoded protein interacts with gankyrin, a liver oncoprotein, and may also play a role in Parkinson's disease through interactions with synphilin-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]'
• Locus ID: 5704