TACC3 (NM_006342) Human 3' UTR Clone

CAT#: SC201628

3`UTR clone of transforming acidic coiled-coil containing protein 3 (TACC3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TACC3
• Synonyms: ERIC-1; ERIC1
• ACCN: NM_006342
• Insert Size: 165
• Sequence Data:
  Insert Sequence

  >SC201628 3'UTR clone of NM_006342
  The sequence shown below is from the reference sequence of NM_006342. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACGACCTCATCTCCAAGATGGAGAAGATCTGACCTCCACGGAGCCGCTGTCCCCGCCCCCCTGCTCCCGT
  CTGTCTGTCCTGTCTGATTCTCTTAGGTGTCATGTTCTTTTTTCTGTCTTGTCTTCAACTTTTTTTAAAA
  CTAGATTGCTTTGAAAACATGACTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006342.1
• Summary: This gene encodes a member of the transforming acidic colied-coil protein family. The encoded protein is a motor spindle protein that may play a role in stabilization of the mitotic spindle. This protein may also play a role in growth a differentiation of certain cancer cells. [provided by RefSeq, Nov 2011]
• Locus ID: 10460