KCNK7 (NM_033347) Human 3' UTR Clone

CAT#: SC201633

3`UTR clone of potassium channel subfamily K member 7 (KCNK7) transcript variant A for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNK7
• Synonyms: K2p7.1; TWIK3
• ACCN: NM_033347
• Insert Size: 161
• Sequence Data:
  Insert Sequence

  >SC201633 3'UTR clone of NM_033347
  The sequence shown below is from the reference sequence of NM_033347. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGCTTCAGGACAAGCCCCTGCTTGCTGAAGCGTCAGGTGACCGAGTTCAGCTCCGTAAGGTGGCGGCA
  CCTGAGGAGGAAGCAGCCAGGAGTGGCTGGGGAAGAATCTGGAGATGGAGCCGCGGTGAGGGTGGGCGGG
  AGGCCTCAGGGGATACTGTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_033347.1
• Summary: This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel; however, it may require other non-pore-forming proteins for activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 10089