GSTA3 (NM_000847) Human 3' UTR Clone

CAT#: SC201667

3`UTR clone of glutathione S-transferase alpha 3 (GSTA3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTA3
• Synonyms: GSTA3-3; GTA3
• ACCN: NM_000847
• Insert Size: 190 bp
• Sequence Data:
  Insert Sequence

  >SC201667 3'UTR clone of NM_000847
  The sequence shown below is from the reference sequence of NM_000847. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGCCAGAAAGATTTTCAGGTTTTAATAAAGCAGCCATGGAGGCTAAGAACATGCAAGACCAATATTCT
  AAAGTTTTGCAACAATGAAGTGCTTTACTTAAGTGTTGATTGTGCCTGTTGTAAAGCTAATGAACCCTTT
  CCAATTATATGCTAATTAAATAATAAAAACTCCTATTTGCTAACTTAGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000847.4
• Summary: 'Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class genes that are located in a cluster mapped to chromosome 6. Genes of the alpha class are highly related and encode enzymes with glutathione peroxidase activity. However, during evolution, this alpha class gene diverged accumulating mutations in the active site that resulted in differences in substrate specificity and catalytic activity. The enzyme encoded by this gene catalyzes the double bond isomerization of precursors for progesterone and testosterone during the biosynthesis of steroid hormones. An additional transcript variant has been identified, but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]'
• Locus ID: 2940