SDHB (NM_003000) Human 3' UTR Clone

CAT#: SC201673

3`UTR clone of succinate dehydrogenase complex subunit B iron sulfur (Ip) (SDHB) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SDHB"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SDHB
Synonyms CWS2; IP; PGL4; SDH; SDH1; SDH2; SDHIP
ACCN NM_003000
Insert Size 182 bp
Sequence Data
>SC201673 3'UTR clone of NM_003000
The sequence shown below is from the reference sequence of NM_003000. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGATGGCAACCTATAAGGAGAAGAAAGCTTCAGTTTAACTGTTTCCATGCTAAACATGATTTATAACCAG
CTCAGAGCTGAACATAATTTATATCTAATTTGAGTTCCTTTAAAGATCTTGGTTTTCCATGAATACAGCA
TGTATAATAAAAATTTTAAGAAATAAATGTTATTCTACTTTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003000.2
Summary 'Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme. Sporadic and familial mutations in this gene result in paragangliomas and pheochromocytoma, and support a link between mitochondrial dysfunction and tumorigenesis. [provided by RefSeq, Jul 2008]'
Locus ID 6390

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.