GTF2IRD1 (NM_005685) Human 3' UTR Clone

CAT#: SC201678

3`UTR clone of GTF2I repeat domain containing 1 (GTF2IRD1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GTF2IRD1
• Synonyms: BEN; CREAM1; GTF3; hMusTRD1alpha1; MUSTRD1; RBAP2; WBS; WBSCR11; WBSCR12
• ACCN: NM_005685
• Insert Size: 174
• Sequence Data:
  Insert Sequence

  >SC201678 3'UTR clone of NM_005685
  The sequence shown below is from the reference sequence of NM_005685. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCTGAACGTGCAGCTCCCGGGACCTCTTAATTACTAGACCTCAGTACTGAATCAGGACCTCACTCAGAA
  AGACTAAAGGAAATGTAATTTATGTACAAAATGTATATTCGGATATGTATCGATGCCTTTTAGTTTTTCC
  AATGATTTTTACACTATATTCCTGCCACCAAGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005685.2
• Summary: The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
• Locus ID: 9569