NFAT1 (NFATC2) (NM_173091) Human 3' UTR Clone

CAT#: SC201695

3`UTR clone of nuclear factor of activated T-cells cytoplasmic calcineurin-dependent 2 (NFATC2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NFATC2
• Synonyms: NFAT1; NFATP
• ACCN: NM_173091
• Insert Size: 185 bp
• Sequence Data:
  Insert Sequence

  >SC201695 3'UTR clone of NM_173091
  The sequence shown below is from the reference sequence of NM_173091. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAGGAGTTTTCAGGACCTCCTGCCAGAAATCAGACGTAAAAGAAGCCATTATAGCAAGACACCTTCTG
  TATCTGACCCCTCGGAGCCCTCCACAGCCCCTCACCTTCTGTCTCCTTTCATGTTCATCTCCCAGCCCGG
  AGTCCACACGCGGATCAATGTATGGGCACTAAGCGGACTCTCACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_173091.2
• Summary: 'This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]'
• Locus ID: 4773