RED (IK) (NM_006083) Human 3' UTR Clone

CAT#: SC201750

3`UTR clone of IK cytokine down-regulator of HLA II (IK) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IK
• Synonyms: CSA2; RED; RER
• ACCN: NM_006083
• Insert Size: 168 bp
• Sequence Data:
  Insert Sequence

  >SC201750 3'UTR clone of NM_006083
  The sequence shown below is from the reference sequence of NM_006083. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGGTTGAAGTCAAAAGACCAAAATACTAATCACTAGTTACAACCAGAGATGCTCCACAAGGATATGCTCC
  CCACTGTTTTCTTTCTACAATTTCCAAAGGTTGCAAGATGTTTTTTTGTGGATGAATATAAAATTTTATT
  GTGTAATTACTTGGTTCCATTAAAATTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006083.3
• Summary: 'The protein encoded by this gene was identified by its RED repeat, a stretch of repeated arginine, glutamic acid and aspartic acid residues. The protein localizes to discrete dots within the nucleus, excluding the nucleolus. Its function is unknown. This gene maps to chromosome 5; however, a pseudogene may exist on chromosome 2. [provided by RefSeq, Jul 2008]'
• Locus ID: 3550