RIP3 (RIPK3) (NM_006871) Human 3' UTR Clone

CAT#: SC201780

3`UTR clone of receptor-interacting serine-threonine kinase 3 (RIPK3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RIPK3
• Synonyms: RIP3
• ACCN: NM_006871
• Insert Size: 180
• Sequence Data:
  Insert Sequence

  >SC201780 3'UTR clone of NM_006871
  The sequence shown below is from the reference sequence of NM_006871. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTTGGTATAATCATAGCGGGAAATAAAGCACCTTCCAAGCTTGCCTCCAAGAGTTACGAGTTAAGGAAG
  AGTGCCACCCCTTGAGGCCCCTGACTTCCTTCTAGGGCAGTCTGGCCTGCCCACAAACTGACTTTGTGAC
  CTGTCCCCCAGGAGTCAATAAACATGATGGAATGCTAGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006871.3
• Summary: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]
• Locus ID: 11035