GTF2IRD1 (NM_016328) Human 3' UTR Clone

CAT#: SC201789

3`UTR clone of GTF2I repeat domain containing 1 (GTF2IRD1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GTF2IRD1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GTF2IRD1
Synonyms BEN; CREAM1; GTF3; hMusTRD1alpha1; MUSTRD1; RBAP2; WBS; WBSCR11; WBSCR12
ACCN NM_016328
Insert Size 174
Sequence Data
>SC201789 3'UTR clone of NM_016328
The sequence shown below is from the reference sequence of NM_016328. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCTGAACGTGCAGCTCCCGGGACCTCTTAATTACTAGACCTCAGTACTGAATCAGGACCTCACTCAGAA
AGACTAAAGGAAATGTAATTTATGTACAAAATGTATATTCGGATATGTATCGATGCCTTTTAGTTTTTCC
AATGATTTTTACACTATATTCCTGCCACCAAGGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016328.1
Summary The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Locus ID 9569

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.