Glutathione Peroxidase 4 (GPX4) (NM_001039847) Human 3' UTR Clone

CAT#: SC201790

3`UTR clone of glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GPX4
• Synonyms: GPx-4; GSHPx-4; MCSP; PHGPx; SMDS; snGPx; snPHGPx
• ACCN: NM_001039847
• Insert Size: 156 bp
• Sequence Data:
  Insert Sequence

  >SC201790 3'UTR clone of NM_001039847
  The sequence shown below is from the reference sequence of NM_001039847. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACGCCCTTGGAGCCTTCCACCGGCACTCATGACGGCCTGCCTGCAAACCTGCTGGTGGGGCAGACCCGA
  AAATCCAGCGTGCACCCCGCCGGAGGAAGGTCCCATGGCCTGCTGGGCTTGGCTCGGCGCCCCCACCCCT
  GGCTACCTTGTGGGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001039847.1
• Summary: 'The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. [provided by RefSeq, Dec 2018]'
• Locus ID: 2879