MTH1 (NUDT1) (NM_198953) Human 3' UTR Clone

CAT#: SC201807

3`UTR clone of nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1) transcript variant 4A for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NUDT1
• Synonyms: MTH1
• ACCN: NM_198953
• Insert Size: 170 bp
• Sequence Data:
  Insert Sequence

  >SC201807 3'UTR clone of NM_198953
  The sequence shown below is from the reference sequence of NM_198953. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGACACCATCCTGGACTACACACTCCGCGAGGTGGACACGGTCTAGCGGGAGCCCAGGGCAGCCCCTGG
  GCAGGAGACGTGGCTGCTGAACAGCCGCAAACCATCTTCACCTGGGGGCATTGAGTGGCGCAGAGCCGGG
  TTTCATCTGGAATTAACTGGATGGAAGGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_198953.1
• Summary: 'Misincorporation of oxidized nucleoside triphosphates into DNA/RNA during replication and transcription can cause mutations that may result in carcinogenesis or neurodegeneration. The protein encoded by this gene is an enzyme that hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP, 8-oxo-dATP, 2-hydroxy-dATP, and 2-hydroxy rATP, to monophosphates, thereby preventing misincorporation. The encoded protein is localized mainly in the cytoplasm, with some in the mitochondria, suggesting that it is involved in the sanitization of nucleotide pools both for nuclear and mitochondrial genomes. Several alternatively spliced transcript variants, some of which encode distinct isoforms, have been identified. Additional variants have been observed, but their full-length natures have not been determined. A rare single-nucleotide polymorphism that results in the production of an additional, longer isoform (p26) has been described. [provided by RefSeq, Dec 2018]'
• Locus ID: 4521