alpha 1 Glycine Receptor (GLRA1) (NM_000171) Human 3' UTR Clone

CAT#: SC201810

3`UTR clone of glycine receptor alpha 1 (GLRA1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GLRA1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GLRA1
Synonyms HKPX1; STHE
ACCN NM_000171
Insert Size 185 bp
Sequence Data
>SC201810 3'UTR clone of NM_000171
The sequence shown below is from the reference sequence of NM_000171. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAGATTGTCCGTAGAGAGGACGTCCACAACCAGTGAAGGGTCTGAAAGGTTGGGGGAGGCTGGGAGAGG
GGAACGTGGGAATAGCACAGGAATCTGAGAGACTAAGGAAGAGAAGGGGAACGGAGGGAGGGGGCACACT
TACACAACTCTCTCTGCAATATGTGCAATAGCAAAATGCAGTGAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000171.3
Summary 'The protein encoded by this gene is a subunit of a pentameric inhibitory glycine receptor, which mediates postsynaptic inhibition in the central nervous system. Defects in this gene are a cause of startle disease (STHE), also known as hereditary hyperekplexia or congenital stiff-person syndrome. Multiple transcript variants encoding different isoforms have been found. [provided by RefSeq, Dec 2015]'
Locus ID 2741

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.