LSM7 (NM_016199) Human 3' UTR Clone

CAT#: SC201823

3`UTR clone of LSM7 homolog U6 small nuclear RNA associated (S. cerevisiae) (LSM7) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LSM7"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LSM7
Synonyms YNL147W
ACCN NM_016199
Insert Size 156
Sequence Data
>SC201823 3'UTR clone of NM_016199
The sequence shown below is from the reference sequence of NM_016199. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTTCATCCAGCAGCAGGACGCCTAGCCTGGCCGGGGGCGCGGGGGGTGCAGGGCAGGCCCGAGCAGCTCG
GTTTCCCGCGGACTTGGCTGCTGCTCCCACCGCAGTACCGCCTCCTGGAACGGAAGCATTTTCCTTTTTG
TATAGGTTGAATTTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016199.2
Summary Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. [supplied by OMIM, Apr 2004]
Locus ID 51690

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.