LSM7 (NM_016199) Human 3' UTR Clone

CAT#: SC201823

3`UTR clone of LSM7 homolog U6 small nuclear RNA associated (S. cerevisiae) (LSM7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LSM7
• Synonyms: YNL147W
• ACCN: NM_016199
• Insert Size: 156
• Sequence Data:
  Insert Sequence

  >SC201823 3'UTR clone of NM_016199
  The sequence shown below is from the reference sequence of NM_016199. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTCATCCAGCAGCAGGACGCCTAGCCTGGCCGGGGGCGCGGGGGGTGCAGGGCAGGCCCGAGCAGCTCG
  GTTTCCCGCGGACTTGGCTGCTGCTCCCACCGCAGTACCGCCTCCTGGAACGGAAGCATTTTCCTTTTTG
  TATAGGTTGAATTTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016199.2
• Summary: Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. [supplied by OMIM, Apr 2004]
• Locus ID: 51690