PMS2 (NM_000535) Human 3' UTR Clone

CAT#: SC201825

3`UTR clone of PMS2 postmeiotic segregation increased 2 (S. cerevisiae) (PMS2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PMS2
• Synonyms: HNPCC4; MLH4; PMS2CL; PMSL2
• ACCN: NM_000535
• Insert Size: 199 bp
• Sequence Data:
  Insert Sequence

  >SC201825 3'UTR clone of NM_000535
  The sequence shown below is from the reference sequence of NM_000535. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAACCATGAGACACATCGCCAACCTGGGTGTCATTTCTCAGAACTGACCGTAGTCACTGTATGGAATAAT
  TGGTTTTATCGCAGATTTTTATGTTTTGAAAGACAGAGTCTTCACTAACCTTTTTTGTTTTAAAATGAAC
  CTGCTACTTAAAAAAAATACACATCACACCCATTTAAAAGTGATCTTGAGAACCTTTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000535.5
• Summary: 'The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]'
• Locus ID: 5395