MAP4K1 (NM_007181) Human 3' UTR Clone

CAT#: SC201848

3`UTR clone of mitogen-activated protein kinase kinase kinase kinase 1 (MAP4K1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAP4K1
• Synonyms: HPK1
• ACCN: NM_007181
• Insert Size: 190
• Sequence Data:
  Insert Sequence

  >SC201848 3'UTR clone of NM_007181
  The sequence shown below is from the reference sequence of NM_007181. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGCCTGTAGTGGTGGAGACACGCCCAGTGGAT
  GATCCTACTGCTCCCAGCAACCTCTACATCCAGGAATGAGTCCCTAGGGGGGTGTCAGGAACTAGTCCTT
  GCACCCCCTCCCCCATAGACACACTAGTGGTCATGGCATGTCCTCATCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_007181.4
• Locus ID: 11184