ERK2 (MAPK1) (NM_138957) Human 3' UTR Clone

CAT#: SC201852

3`UTR clone of mitogen-activated protein kinase 1 (MAPK1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAPK1
• Synonyms: ERK; ERK-2; ERK2; ERT1; MAPK2; p38; p40; p41; p41mapk; p42-MAPK; P42MAPK; PRKM1; PRKM2
• ACCN: NM_138957
• Insert Size: 205 bp
• Sequence Data:
  Insert Sequence

  >SC201852 3'UTR clone of NM_138957
  The sequence shown below is from the reference sequence of NM_138957. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGACTGCTAGATTCCAGCCAGGATACAGATCTTAAATTTGTCAGGTACCTGGAGTTTAATACAGTGAGC
  TCTAGCAAGGGAGGCGCTGCCTTTTGTTTCTAGAATATTATGTTCCTCAAGGTCCATTATTTTGTATTCT
  TTTCCAAGCTCCTTATTGGAAGGTATTTTTTTAAATTTAGAATTAAAAATTATTTAGAAAGTTAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_138957.2
• Summary: 'This gene encodes a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. One study also suggests that this protein acts as a transcriptional repressor independent of its kinase activity. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jan 2014]'
• Locus ID: 5594