RPB2 (POLR2B) (NM_000938) Human 3' UTR Clone

CAT#: SC201911

3`UTR clone of polymerase (RNA) II (DNA directed) polypeptide B 140kDa (POLR2B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLR2B
• Synonyms: hRPB140; POL2RB; RPB2
• ACCN: NM_000938
• Insert Size: 209 bp
• Sequence Data:
  Insert Sequence

  >SC201911 3'UTR clone of NM_000938
  The sequence shown below is from the reference sequence of NM_000938. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTATTGCACCGCGAATGATGAGTGTTTAGCTATTTTACAGGAGTCAACAAGATAATTAAATATCTTGGTG
  TCTTGTTTCTATTGTGTGGCTTTATAAAAATGACAAATATGTACTGTGTTGTGATAAAAAGTATTTTATT
  TGTTTAATGATATGCATGCTTTTCTTCTGTAAATATATAATAAATTTTTGTAGATAGTCTTGATGTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000938.1
• Summary: 'This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]'
• Locus ID: 5431